google-site-verification=xhpeAI2RUbsWSW_zadE7zWqrzjVodntlT_-8Q4lfi10
Wild Angara Sibirische "Wald"Katzen aus dem Ruhrgebiet
Wild Angara Sibirische Wald"Katzen" Hobbyzucht aus dem Ruhrgebiet
Wild Angara - Sibirische "Wald" Katzen aus dem Ruhrgebiet
Direkt zum Seiteninhalt
Bericht 1
aus einer amerkanischen Studie

Viele sibirische Züchter (sowie Züchter von Sphinx und Cornish Rex) haben irreführende Behauptungen über den Allergengehalt dieser Rassen gemacht.  Siberian Research hat in enger Zusammenarbeit mit mehreren Züchtern über 300 Sibirier getestet und Kätzchen aus über 100 Paarungen untersucht.  Wir haben umfangreiche Untersuchungen zum Allergenspiegel von Sibiriern und verschiedenen anderen Rassen durchgeführt.  Einige der häufigsten irreführenden Ideen werden unten diskutiert.

 Mythos - Alle Sibirier sind hypoallergen.
 Sibirian Research hat Testdaten aus über 300 Proben von sibirischem Speichel und Fell gesammelt.  Etwa die Hälfte der Sibirier hatte Allergenwerte, die deutlich unter den normalen Straßenkatzen lagen.  Einige Sibirier hatten außergewöhnlich niedrige Allergenwerte.  Diese Katzen mit sehr geringem Allergengehalt könnten in Häusern mit schweren Katzenallergien untergebracht werden.  Einige Sibirier testeten mit sehr hohen Allergenwerten und verursachten schwere allergische Reaktionen.

 Mythos - Sibirier produzieren kein Fel-d1-Allergen
 Alle bisher getesteten Sibirier produzierten etwas Fel-d1-Allergen, obwohl einige nur eine sehr geringe Menge produzieren.  Es gibt immer mehr Beweise dafür, dass Fel-d1 eine entscheidende Funktion bei der frühen Entwicklung von Kätzchen erfüllt.  Straßenkatzen zeigen ein breites Spektrum in d1 und ein noch breiteres Spektrum ist bei den Sibiriern zu beobachten.

Mythos - Sibirier produzieren eine andere Art von Fel-d1
 Das Katzen-Allergen (Fel-d1) von Sibirier wurde sowohl strukturell als auch chemisch getestet.  Weder im strukturellen noch im chemischen Aufbau von Siberian Fel-d1 wurden Veränderungen gefunden.  Es gibt keine Beweise, die die Behauptung stützen, dass Sibirisches Fel-d1 von dem bei anderen Katzen gefundenen Allergen verschieden ist.

 Mythos - Männliche Katzen haben immer mehr Allergen als Weiblichen.
 Stud-Männchen in zehn sibirischen Catteries wurden detailliert untersucht.  Männchen mit niedrigem Allergengehalt wurden den Weibchen mit niedrigem Allergengehalt sehr ähnlich getestet.  Diese Männchen neigten dazu, weniger Reaktionen bei den Katzenbesuchern hervorzurufen als die Zuchtkätzin.  Bei Katzen mit normalen Fel-d1-Spiegeln sind die Allergenspiegel nicht kastrierter Katern höher als bei Katzen, obwohl die Spiegel durch Kastration reduziert wurden.
 Mythos - Fellversuche sind sehr genau.
Felluntersuchungen sind viel einfacher durchzuführen als die Entnahme von Speichel, die Ergebnisse bei Jungtieren und Müttern können jedoch sehr ungenau sein.  Das Niveau von Fel-d1 im Mantel der Mutter während der späten Schwangerschaft und Stillzeit ist tendenziell viel höher als normal, und sie neigen dazu, während dieser Zeit mehr Reaktionen bei den Katzenbesuchern auszulösen.  Die Fellniveaus in Katern steigen in der Saison von März bis Oktober tendenziell an.

Mythos - Speicheltests sind immer genau.
 Sibirian Research empfiehlt dringend eine erneute Prüfung, wenn Fragen zur Gültigkeit der Stichprobe bestehen.  Wiederholte Speicheltests zeigen, dass die aktuellen Tests zu etwa 80% genau sind.
 Speicheluntersuchungen sind genauer als die Probenahme von Fell, es wurden jedoch mehrere Probleme gefunden.  Die von SRI verwendeten älteren Speicheltestmethoden haben eine viel höhere Fehlerrate als die derzeit bei KittenTesting.com verfügbaren Tests

 Mythos - Kätzchen von Allergikern sind weniger Allergene.
 Paarungen aus mehreren sibirischen Catteries wurden untersucht und die Jungtiere wurden während ihrer Reifung auf Fel-d1-Produktion überwacht.  Die Ergebnisse waren sehr konsistent und zeigten ein Muster der beteiligten Genetik.  Die meisten Paarungen mit wenig Allergenen sind in der Lage, bei Kätzchen normale Allergenkonzentrationen zu erzeugen.
  1.  Wenn der Vater und der Mutter normale Fel D 1 -Niveaus haben, neigen alle Kätzchen dazu, normale Allergenspiegel zu haben.
  2.  Wenn entweder der Vater oder die Mutter einen niedrigeren Fel D 1 -Gehalt hat, hat etwa die Hälfte der Jungtiere weniger Allergenwerte als normal - wenn auch nicht außergewöhnlich niedrig.
  3.  Wenn sowohl der Vater als auch die Mutter ein geringes Allergen haben, bewegen sich die Jungtiere von sehr niedrig bis vollnormal (hohes Allergen).
Die sibirische Katze: eine hypoallergene Rasse ?!
 Die Sibirische Katze ist ein prächtiges Exemplar: kräftig, maskulin, schlau, mit üppigen und mittellangen Haaren, witzigen und tiefen Augen.   Diese Katze zeichnet sich durch ihre Schönheit und ihre enge Verbindung  zur Wildkatze aus: Sie ist der Sohn einer natürlichen Selektion  zwischen dieser und einem von den frühen Siedlern nach Sibirien gebrachten Exemplar einer Hauskatze .  Es hat auch andere Gründe, um berühmt zu sein: Es produziert eine minimale Menge des Fel D1-Proteins , das für häufige Allergien gegen das Fell verantwortlich ist.  Deshalb ist es als hypoallergene Katze bekannt .

Was ist die Allergie gegen die Katzen?
 Katzenhaarallergie ist ein Phänomen, das jeden Menschen sowohl im Säuglingsalter als auch im Erwachsenenalter betreffen kann.  Diejenigen, die leiden, sind oft gezwungen, die Firma Mikros aufzugeben.  Die Ursache der Allergie liegt in einem Protein namens Fel D, das von den Talgdrüsen produziert wird und im Speichel der Katze enthalten ist .   Ein solches Protein setzt sich durch die Toilette, der die Katze  täglich ausgesetzt ist, auf den Haaren ab, die zum Überträger werden:  Das Allergen ist daher im Speichel enthalten, und die Haare der Katze sind nur das Medium, durch das sie sich ausbreiten!

Der Vorteil der Sibirischen Katze
Im Gegensatz zu anderen Katzen enthält die sibirische Rasse sehr wenig Eiweiß, das für die Allergie verantwortlich ist .   Dies sind die neuesten Forschungsergebnisse an der University of  California, die dies erklären: Es ist sicher, dass diese Rasse von der  Fähigkeit, Fel D1 herzustellen, fast unberührt bleibt.  Andere Tests gingen noch weiter: Laut den Tests des Labors von Indoor Biotechnologies in Virginia (USA) produziert der sibirische Kater durchschnittlich 2.000 mg Fel D1 gegen die 62.000 der gemeinen Katze.  Stattdessen produziert die Sibirische Katze nur 205 mg.

Der Traum von Katzenliebhabern, die an Allergien leiden
 Das Vergnügen, mit einer Katze zu leben, wird daher von niemandem blockiert!  Wir empfehlen jedoch präventive Treffen mit Sibirischen Katzen .   Obwohl in kleinen Mengen das Protein immer noch vorhanden ist, kann es  auch zu Beschwerden kommen, bei denen die Allergie besonders empfindlich  ist.
Es ist auch ratsam, sich an seriöse und referenzierte Züchter zu wenden , die die Gewissheit haben, dass sie die faszinierende sibirische Reinzucht haben .

Hier das ganze streng Wissenschaftlich - was erklärt warum es bei manchen Sibieren wohl nicht so funktioniert:

 Tierarzt
 Wissenschaften
 Kommunikation
 Polymorphismusanalyse von Ch1 - und Ch2 - Genen im
 Sibirische Katze
 Stefano Sartore *, Eleonora Landoni, Sandra Maione, Alberto Tarducci, Antonio Borrelli,
 Dominga Soglia ID  , Roberto Rasero und Paola Sacchi ID
 Veterinärmedizinische Abteilung, Universität Turin, 10095 Grugliasco, Italien;
 eleonora.landoni@gmail.com (EL);  sandra.maione@unito.it (SM);  alberto.tarducci@unito.it (AT);
 antonio.borrelli@unito.it (AB);  dominga.soglia@unito.it (DS);  roberto.rasero@unito.it (RR);
 paola.sacchi@unito.it (PS)
 * Korrespondenz: stefano.sartore@unito.it;  Tel .: + 39-11-6709-257
 Akademischer Herausgeber: Patrick Butaye
 Erhalten: 26. September 2017;  Akzeptiert: 29. November 2017;  Veröffentlicht am: 1. Dezember 2017
 Zusammenfassung: Katzen verbreiten in der Regel Allergene, die für empfindliche Menschen von entscheidender Bedeutung sind.  die sibirische katze
 ist eine Rasse, die nach Angaben einiger Züchter vermutlich allergen ist.  Die Sequenz
 von den zwei Genen, nämlich Ch1 und Ch2, die für das Allergen Fel d 1 kodieren, das Hauptallergen, das dafür verantwortlich ist
 Bei Ausbrüchen von Allergiesymptomen ist bei der Sibirischen Katze noch nichts bekannt, und dies zu finden war das Ziel
 unserer Untersuchung.  Unsere Arbeit ist vor allem der erste Überblick über die genetische Struktur dieser Gene in
 Sibirische Katzen  Der Vergleich der Sequenzen von Sibirischen Katzen, Nicht-Sibirischen Katzen und Sequenzen
 Die in der Informationsdatenbank des Nationalen Zentrums für Biotechnologie vorhandenen Daten haben eine beträchtliche
 Anzahl der Mutationen;  einige von denen, die bei der Sibirischen Katze aufgrund ihrer Position in Exon-Regionen entdeckt wurden,
 kann die allergischen Eigenschaften von Fel d 1 beeinflussen.  Daher werden weitere Untersuchungen empfohlen
 beurteilen,  ob die identifizierten Mutationen für eine reduzierte Allergensynthese  verantwortlich sind und verwendet werden können
 als Marker für die Auswahl von allergiearmen Katzen.
 Schlüsselwörter: Fel d 1;  Sibirische Katze;  Ch1-Gen;  Ch2-Gen;  genetische Selektion;  allergikerfreundliche katze
 1. Einleitung
 Katzen (Felis catus) sind ziemlich zerstreute Haustiere, die wegen ihrer Schönheit und ihres Eigensinns bewundert werden
 Temperament;  Leider verbreiten sie auch Allergene, die für Allergiker kritisch sind,
 und in einigen extremen und dramatischen Fällen sind die Besitzer traurig gezwungen, die Katze aus ihrem Haus zu entfernen
 Gesundheitsprobleme vermeiden.  Diese Allergene haben das Potenzial, den Ausbruch von Symptomen mit auszulösen
 verschiedene Schweregrade: Sie können von gewöhnlichen Beschwerden wie Rhinitis und Konjunktivitis abweichen
 möglicherweise lebensbedrohliche asthmatische Krise [  1   - 3   ].  In dieser Hinsicht ist die Auswahl von Allergenen gering
 Katzen könnten eine neue Möglichkeit für Allergiker sein, die ihr Lieblingshaustier bei sich zu Hause haben möchten.
 Fel d 1, das Hauptallergen der Katzen, ist ein tetrameres Protein von 35–40 kDa, bestehend aus
 zwei Heterodimer von 18–20 kDa [  4   - 6   ].  Jede Untereinheit umfasst zwei Polypeptidketten, Kette 1 und
 Kette 2, codiert durch zwei getrennte Gene, nämlich Ch1 und Ch2.  Fel d 1 ist in erster Linie ein Sekretoglobulin
 produziert in Talgdrüsen-, Anal- und Speicheldrüsen und ist auf der Tierhaut und Tierhaut vorhanden
 Folge der Pflege [  7   - 9   ].  Allergiker reagieren zwar mit einer Vielzahl von Proteinen
 in Katzenfellen gefunden [  10   , 11   ], Fel d 1 ist das prominenteste Allergen und die klinische Genauigkeit davon
 Der Befund wurde durch Untersuchungen bestätigt, die das Fel d 1 -spezifische IgE im Serum von etwa 80% nachweisen.
 von katzenallergischen Patienten [  10   - 12   ].  Es ist erwähnenswert, dass Häuser mit Katzen oft in der Luft sind
 Fel d 1, das mehr als genug ist, um eine Asthmakrise bei hochsensiblen Bewohnern auszulösen [  13   14   ].
 In einer früheren Umfrage [  fünfzehn   ], die Existenz von hypoallergenen Katzen aufgrund einer geringeren Produktion von Fel d 1
 Protein wurde angegeben;  Ziel dieser Untersuchung war es daher, die Sequenzen der beiden Gene zu analysieren
 Tierarzt.  Sci.  2017 , 4, 63;  doi : 10.3390 / vetsci4040063
 www.mdpi.com/journal/vetsci

 Seite 2
 Tierarzt.  Sci.  2017 , 4, 63
 2 von 5
 (Ch1 und Ch2) kodiert für das Fel d 1 -Protein bei einigen sibirischen Katzen, einer angeblich geringgradigen allergenen Rasse
 entsprechend einigen Züchteraussagen.  Unsere Arbeit ist vor allem der erste Überblick über die genetische Struktur von
 Diese Gene bei Sibirischen Katzen identifizieren molekulare Unterschiede zwischen Sibirischen und Nicht-Sibirischen Katzen.
 2. Materialien und Methoden
 Bei 39 Katzen wurden Blutproben genommen, nämlich 4 Sibirier und 35 Nicht-Sibirier.
 Drei sibirische Katzen wurden zuvor auf die Konzentration von Fel d 1 im Speichel getestet
 (privates Labor, Charlottesville, VA, USA), was zu 2,19, 1,66 und 0,48 µg / ml führt.  DNA wurde extrahiert
 mit NucleoSpin Blood Quick Pure Kit (Macherey-Nagel GmbH, Duren, Deutschland) und Ch1 und Ch2
 Die Gene wurden durch PCR mit einem 2720 AB Thermal Cycler Device nach einem vorgeschlagenen Protokoll amplifiziert
 durch die Literatur [  16   ].  Die Primersequenzen waren wie folgt:
 
 5 GGGGATCCTGGAACACCATGTTAGACGCAG3 (vorwärts)
 
 5 GGGAATTCTGCAGTTACCTTTAACACAGAG3 (Reverse) für Ch1;
 
 5 GGGCTGCAGATTCTAGTCAGCCTGATTGA3 (vorwärts)
 
 5 GGGGATCCTGACACCATGAGGGGGGCA3 (Reverse) für Ch2.
 Die Amplikons von vier sibirischen und fünf nicht sibirischen Katzen wurden vom NGS analysiert
 (Next Generation Sequencing) -Technik unter Verwendung des Miseq-Systems (Illumina, CA, USA).
 Der Variantenaufruf für jede Probe wurde mit dem Miseq Reporter-Softwaretool durchgeführt
 (Illumina, CA, USA).  Die Mutationspunkte in sibirischen und kurzhaarigen Amplicons wurden verglichen
 mit dem Nationalen Zentrum für Biotechnologie-Informationen (NCBI, [  17   ]) Sequenzen X62477 (Felis-catus-Gen
 für Fel d 1 -Proteinkette 1) und X62478 (Felis-catus-Gen für Fel d 1 -Proteinkette 2).  Die Grafik
 Die Darstellung der identifizierten Mutationspunkte wurde im NCBI-Tool Genome Workbench realisiert.
 3. Ergebnisse
 Die Amplifikationen lieferten Fragmente von ungefähr 1700 bp und 2500 bp von Ch1 und
 Ch2.
 Für Ch1 wurden Sequenzierungsdaten von einem Sibirier und einem Nicht-Sibirier wegen deren verworfen
 lieferte eine sehr geringe Anzahl von Lesevorgängen.  Über 90% beider Gene waren im Durchschnitt bedeckt
 Tiefe über 200X.  Im Durchschnitt hatten 88,5% von Ch1 (von etwa 150 bis 1700) eine Sequenz
 geeignet für Variantenaufruf (Lesetiefe> 20), mit Ausnahme einer Lücke zwischen Basis 1094 und Basis 1194,
 wahrscheinlich aufgrund einer sich wiederholenden Region.  Für Ch2 hatten 84,2% der Gene (von etwa Basis 212 bis Basis 2250) eine
 Lesetiefe> 20X (Abbildung 1   ).
 Lesetiefe> 20X (Abbildung  1).
 Abbildung 1. Grafische Darstellung der Sequenzabdeckung und Ausrichtung der Referenzsequenz
 Abbildung 1. Grafische Darstellung der Sequenzabdeckung und Ausrichtung der Referenzsequenz
 der Ch1- und Ch2-Gene.  E = kurzhaarige Katze.  S = Sibirische Katze

 Seite 3
 Tierarzt.  Sci.  2017 , 4, 63
 3 von 5
 Der Vergleich zwischen kurzhaarigen Katzen und NCBI X62477 (DNA) /NM_001048153.1 (mRNA)
 und X62478 (DNA) /NM_001048154.1 (mRNA) enthüllten 36 Mutationen in Ch1 und 88 Mutationen in Ch2,
 Sibirische Katzen zeigten im Vergleich zu den gleichen Referenzsequenzen 45 Mutationen in Ch1 und
 93 Mutationen in Ch2.  Fokussierung der Aufmerksamkeit auf Mutationspunkte bei Sibirischen Katzen im Vergleich
 Bei kurzhaarigen Katzen wurden 13 Mutationen in Ch1 und 8 Mutationen in Ch2 nur in Sibirien nachgewiesen.
 nämlich 11 Mutationen in Ch1 Intron 3 und 7 in Ch2 Introns 1 und 2. In Exon 1 von Ch1 ein Sibirier
 cat zeigte eine stille Mutation in Position 119 auf X62477 (g.119T> C).  In der gleichen Region des
 Gen zeigte eine andere sibirische Katze eine Missense-Mutation, die eine p.A13S-Substitution in Position verursachte
 138 (g.138G> T) (Tabelle 1   Nr. 37);  In Ch2 zeigte die gleiche Katze eine Missense-Mutation, die p.N85S verursachte
 Substitution in Position 2231 auf X62478 (g.2231A> G).  Bei allen sibirischen Katzen eine Deletion von 6 Nukleotiden
 Der Verlust von 2 Serinen (p.S85_S86del) wurde lokalisiert, was c.260_265delAGCTCC entspricht
 am NM_001048154.1;  Die Streichung war auch auf X62478 ab Position 2230 vorhanden
 mit einigen, aber nicht allen Kurzhaarkatzen geteilt.
 Tabelle 1. Hauptmutationen, die die kodierende Sequenz der Ch1- und Ch2-Gene in einigen Sibirischen Katzen beeinflussen:
 Position auf einer GenBank-Referenzsequenz, Auswirkungen auf die Aminosäuresequenz und Fel d 1 -Konzentration in
 Speichel.  Minus- und Pluszeichen bedeuten das Fehlen oder Vorhandensein der Mutation.


Zurück zum Seiteninhalt